Skip to main content
Sustainable Chemical Processes
Download PDF
Download ePub
  • Research article
  • Open access
  • Published:

Isolation, purification and characterization of Trichothecinol-A produced by endophytic fungus Trichotheciumsp. and its antifungal, anticancer and antimetastatic activities

Sustainable Chemical Processes volume 2, Article number: 8 (2014) Cite this article

Abstract

Background

A total of 30 endophytic fungi (AAP-PS 1–30) were isolated from the medicinal herb Phyllanthus amarus and screened for the production of Trichothecinol-A. Out of all the endophytic strains screened for Trichothecinol-A production, the culture filtrate of AAP-PS-1 extracted with ethyl acetate yielded Trichothecinol-A extracellularly in appreciable amounts. Trichothecinol-A was purified, quantified and completely characterized by different standard chromatographic and spectroscopic techniques including reverse phase HPLC, 1D and 2D NMR spectroscopy, etc. The compound was tested for antifungal activity against filamentous fungi and yeast, apoptotic activity against B16F10 cells, anticancer activity against MDA-MB-231, HeLa and B16F10 cells as well as antimetastatic activity against MDA-MB-231 cell line.

Results

The endophyte producing Trichothecinol-A was identified as Trichothecium sp. by morphological, cultural and molecular methods. RP-HPLC analyses performed on a Waters model using a C18 symmetry pack column with a flow rate of 0.5 ml/min and the eluting compounds were detected by a dual mode wavelength detector set at 220 nm and 240 nm. The 1D (1H, 13C) and 2D NMR (COSY, NOESY, TOCSY, DEPT, 13C–1H HMBC, 13C–1H HSQC), ESI-MS, HRMS, IR and UV–vis show conclusively that the isolated compound was Trichothecinol–A. One liter of Trichothecium sp. yielded 4.37 mg of Trichothecinol-A. Trichothecinol-A exhibited antifungal activity against Cryptococcus albidus (NCIM 3372) up to 20 μg/ml. Cytotoxicity studies indicate that Trichothecinol-A causes 50% cell death at 500nM concentration in HeLa and B16F10 cells and induces apoptosis in later. Inhibition of wound migration assay performed on MDA-MB-231 cells reveals that 500nM of Trichothecinol-A was able to inhibit wound migration by 50% indicating its remarkable antimetastatic property.

Conclusion

The compound Trichothecinol-A has previously been isolated from Trichothecium roseum and characterized by various standard techniques. Anti-cancer studies conducted on Trichothecinol-A showed that it significantly inhibits cancer cell migration and can thus be developed as a new class of anti-metastatic drug. Here, we for the first time report the anti-metastatic as well as anti-fungal activity exhibited by Trichothecinol-A isolated by us from the endophytic fungus Trichothecium sp. of medicinal plant Phyllanthus amarus. Trichothecinol-A also exhibited apoptotic activity.

Background

Endophytic fungi are microorganisms which spend the whole or part of their life-cycle residing symbiotically within the healthy tissues of host plants, inter-and/or intra-cellularly and produce bioactive natural products or drugs and derivatives; meanwhile causing no damage or disease to their hosts [1].

Owing to the huge developments in the fields of genetic engineering, microbial fermentation technology, etc. the past two decades have seen a major increase in the number of researchers working hard to explore the endophytic fungal diversity, and better understand the relationships between endophytic fungi and their host plants, in an attempt to employ endophytes to obtain valuable compounds of plant origin without exploiting plant parts and to improve the productivity of the ones already being derived by optimizing fermentation conditions to reap benefits of abundant renewable supply [2, 3]. Thus, endophytes hold tremendous promise as an alternative eco-friendly source for efficiently producing valuable bioactive compounds in the future with varied applications in both the research and applied fields of medicine, food industry, agriculture, pest management, etc.

Trichothecenes are a vast group of structurally and chemically related mycotoxins which have a strong impact on the health and well-being of humans, plants and farm animals. These mycotoxins are complex sesquiterpene secondary metabolites produced by fungi belonging to various species of Fusarium, Trichothecium, Trichoderma, Myrothecium, Cephalosporium, Stachybotrys, etc. These mycotoxins are highly stable even during the milling, processing and cooking of food stuffs and thus it’s very difficult to get rid of them [4, 5]. It is these trichothecenes which are responsible for the toxicity and spoilage of grains, fruits, vegetables, tubers and other vegetative products worldwide.

Trichothecenes are minute, amphiphatic molecules which are extremely powerful inhibitors of protein synthesis as these have their specific site of action located on a very crucial site on the ribosomal RNA (rRNA), thus interfering with the normal polypeptide chain initiation, elongation and termination [6, 7]. Altering the biological activity of trichothecenes has helped in inducing anti-bacterial, anti-viral, insecticidal, phytotoxic, cytoxic, anti-biotic and anti-tumour properties in the resultant molecules [8]. Konishi et al. reported the trichothecinols A–C, all showing remarkable potential at inhibiting EBV-EA activation induced by TPA (12-O-tetradecanoylphorbol-13-acetate) in Raji cells [9]. Out of these, the most active compound, Trichothecinol-A also suppressed TPA-induced tumour promotion on mouse skin initiated with DMBA (7,12-dimethylbenz[a]anthracene) in a two-stage carcinogenesis experiment.

As part of our ongoing research for plant based drugs using endophytic fungi, we started the isolation and screening of endophytic fungi from medicinal herb Phyllanthus amarus for the production of various beneficial bioactive secondary metabolites and identified a fungal strain Trichothecium sp. which during the present investigation produced only antifungal secondary metabolites against Aspergillus niger. The compound was identified as sesquiterpenoid trichothecene mycotoxin and completely characterized as Trichothecinol-A. P. amarus was used as it is a known astringent, deobstruent, stomachic, diuretic, febrifugal, antiseptic, employed in dropsy and diseases of urinogenital system; its leaves are expectorant, diaphoretic; seeds are carminative, laxative, astringent to the bowels, tonic to the liver, and used as a remedy for bronchitis, earache, griping, opthalmia and ascites [10–13]. Fresh roots and leaves of this plant have also been reported to be potent remedy for jaundice. All these features made P. amarus a very worthy candidate for our study.

The present work focuses on the isolation, purification and complete characterization of Trichothecinol-A from the endophytic fungus Trichothecium sp. isolated from P. amarus. The anti-fungal, anti-cancer (anti-proliferative), anti-metastatic and apoptotic activities of trichothecinol-A revealed its class-apart potential to be developed as a drug for each mentioned field.

Results and discussion

Isolation, purification and identification of endophytic fungus producing Trichothecinol-A

Total thirty endophytic fungi were isolated from leaves and stems of P. amarus and only one culture (AAP-PS-1) isolated from leaves was found to produce Trichothecinol-A extracellularly. Trichothecinol-A producing fungal culture was identified using molecular and morphological approaches. Morphological observations revealed that conidiophores were long, slender, simple, bearing conidia singly, apically, sometimes held together in groups or chains; conidia were hyaline, 2-celled and ovoid to ellipsoid.

Amplification of fungal genomic DNA by primers ITS1 and ITS4 yielded 650 bps fragment (Accession No. JN603460). The analysis of sequence revealed 99.9% identity with that of Trichothecium roseum. Phylogenetic analysis of this strain AAP-PS-1 based on ITS sequences exhibited 98% nucleotide sequence similarity with Trichothecium roseum, the phylogenetically closest validated genus (Figure 1). The ITS sequence analysis and homology alignment of isolate AAP-PS-1 using BLAST and Clustal-W programme respectively revealed similarity with T. roseum. Also, morphological and cultural studies confirm that the isolate belongs to genus Trichothecium[14].

Figure 1
figure 1

Phylogenetic tree highlighting the position of Trichothecium sp. within the closely related genus. GenBank accession numbers are indicated in parentheses. The scale bar represents a 5% nucleotide sequence divergence.

Full size image

Purification, quantification and complete characterization of Trichothecinol-A

Purified Trichothecinol-A eluted at retention time of 34 minutes when loaded on analytical C18 symmetry pack column with a flow rate of 0.5 mL/min. EtoAc extract of one litre of filterate of Trichothecium sp. fermented in modified S7 medium yielded 4.37 mg of Trichothecinol-A. Maximum UV absorption was recorded at 251 nm in ethyl acetate. The mass spectrum showed molecular ion at m/z 349.57 and at m/z 371.28 attributing to M + H and M + Na ions of Trichothecinol-A respectively. The HRMS spectrum showed molecular ion at 348.0683 attributing to ions of Trichothecinol-A (C19H24O6). The FTIR spectrum showed characteristic bands of Trichothecinol-A at 1679, 1721 and 3452 cm−1. (HPLC details, UV-visible spectroscopy measurements, FTIR spectroscopy measurements, ESI-MS details are included as supporting information (Additional file 1: Figure S1 – S4).

The 1H NMR spectrum of the Trichothecinol-A showed the presence of 24 protons with the olefinic peaks in side chain ester linkage at ~6.48δ, 5.89δ and the ring olefinic proton at ~6.60δ. The methyl groups (Me 14, 15, 16 and 20) appeared at ~0.76δ, ~1.03 δ, ~1.83δ and ~2.17δ, respectively. The protons of epoxide methylene group (13a, 13b) appeared as doublets at ~2.81δ and ~3.08δ. The other methylene group (7a, 7b) resonated at ~2.33δ and ~2.96δ. The most noticeable feature of the 1H spectrum is the presence of a broad peak at ~3.48δ which belongs to OH group proton. 13C NMR spectrum showed the presence of 19 carbons which included two carbonyls (198.52δ, 168.05δ), four olefinic (148δ to 119δ) and thirteen sp3 carbons in the region 85δ to 5δ. The assignments of the 1H and 13C spectra are presented in Table 1 and Figure 2. The spectral details are included as Supporting information (Additional file 1: Figures S5-S12, Tables S1 and S2). The NMR spectral features are found to match very well with the one reported by Konishi et al. [9].

Table 1 1 H and 13 C NMR assignments* of Trichothecinol-A
Full size table
Figure 2
figure 2

Selected nOe interactions of Trichothecinol-A (Mw: 348, C 19 H 24 O 6 ).

Full size image

Antifungal activity of Trichothecinol-A

In contrary to earlier reports [9], we for the first time demonstrated antifungal activity of Trichothecinol-A against a range of filamentous fungi and yeast. Trichothecinol-A exhibited moderate activity against yeast Cryptococcus albidus var diffluens NCIM 3372 up to 20 μg/mL. MIC and IC50 values were determined as described below (Table 2). Dose response curves of Trichothecinol-A are included as supporting information (Additional file 1: Figure S13).

Table 2 MIC and IC 50 values of Trichothecinol-A
Full size table

Trichothecinol-A exhibit cytotoxicity at nanomolar concentrations against B16F10 and HeLa cells and effectively inhibit cell migration in MDA-MB-231 cells

Cytotoxicity studies indicated that B16F10 and HeLa cells show enhanced sensitivity to Trichothecinol-A compared to MDA-MB-231 cells. Trichothecinol-A induced about 50% cell death in HeLa and B16F10 cells compared to about 25% in MDA-MB-231 cells at 500 nM concentrations (Figure 3).

Figure 3
figure 3

Effect of Trichothecinol-A on cancer cell proliferation. MDA-MB-231, HeLa and B16F10 cells were treated with DMSO as vehicle control and with Trichothecinol-A at varying concentrations from 0–100 μM for 24 h and cell viability was determined by MTT assay.

Full size image

The effect of Trichothecinol-A on B16F10 cell death was performed by cell cycle analysis. Briefly, cells were treated with Trichothecinol-A in a dose of 0–5 μM for 12 and 24 h respectively and then stained with PI (propidium iodide). The DNA fluorescence histogram of PI-stained cells revealed a distinct quantifiable region beyond G1 peak (Figure 4).

Figure 4
figure 4

Cell Cycle analysis of B16F10 cells by Flow Cytometry: B16 F10 cells were treated with DMSO as vehicle control or with Trichothecinol-A at concentrations of 0–5 μM for 12 and 24 h respectively and cell cycle distribution was determined by measuring DNA content using flow cytometry.

Full size image

Significant increase in the sub G0 population was observed in Trichothecinol-A treated cells in a time dependent manner. 500 nM of Trichothecinol-A had 12.7% sub G0 population as compared to 3.88% in vehicle control in 12 h. However, cells treated with 500 nM of Trichothecinol-A for 24 h resulted in an increase of apoptotic fraction to 52.96% versus 16.68% in vehicle control.

Enhanced migratory capacity is one of the hall marks of highly invasive tumor cells. Inhibition of cancer cell migration could be an effective means of preventing cancer metastasis, thereby enabling confinement of primary tumors in manageable form, making surgical options more viable [15]. During opening phase of the metastatic cascade, cancer cells penetrate into surrounding tissues and blood vessels and it has been shown to be the rate limiting step in an experimental model [16]. Therefore, inhibition of the cell migration represents a potential therapeutic approach for the treatment of tumor metastasis. Here, we studied the inhibitory effect of Trichothecinol-A in MDA-MB-231 cell migration at various concentrations. Percentage of wound closure was determined by the difference in area covered by migrated cells in control versus treated with Trichothecinol-A at 0 or 18 h. The results show that the 500 nM of Trichothecinol-A was able to inhibit wound closure by 50% where as 2.5 and 5 μM concentrations of Trichothecinol-A inhibited migration up to 75% as compared to vehicle control (Figure 5a & b).

Figure 5
figure 5

Inhibition of cell migration by Trichothecinol-A: a. MDA-MB-231 cells were treated with DMSO as vehicle and Trichothecinol-A at concentrations of 0–5 μm for 18 h and photographs were taken. b. The areas of migrated cells were quantified and represented as bar graph. *p = .0013, **p = .0003 vs. vehicle control.

Full size image

Because, the common approach of chemotherapy is to decrease the growth rate (cell division) of the cancer cells, the side effects are seen in bodily systems that naturally have a rapid turnover of cells including skin, hair, gastrointestinal and bone marrow. These healthy, normal cells also end up damaged by the chemotherapy program. Hence, it’s reasonable to look out for compounds with antimetastatic activity which could be further developed as lead against cancer metastasis. As, Trichothecinol-A is showing promising antimetastatic activity against human breast carcinoma (MDA-MBA-231) and antiproliferative activity against skin carcinoma (B16F10) at nanomolar concentration, therefore, it can be used as scaffold in drug discovery programme to synthesize analogues with better specificity and favourable pharmacological properties. Further efforts are needed to modify the compound to remove sites of non specific toxicity and understand the mechanism by which this compound inhibits cancer cell growth and migration.

Materials and methods

Isolation, purification, identification and screening of endophytic fungi for the production of Trichothecinol – A

A total of 30 endophytic fungi (AAP-PS 1–30) were isolated from medicinal herb P. amarus as described elsewhere [17–19]. Each fungal culture was checked for purity and transferred to agar slants by hyphal tip as well as single spore isolation method [17, 20]. Production of Trichothecinol-A by endophytic fungi was studied by a two stage fermentation procedure [21]. The flasks containing MGYP media (Malt extract 0.3%, Glucose 1%, Yeast extract 0.3%, Peptone 0.5%) were inoculated with agar plugs of mycelium from 7 day old slants. The inoculated flasks were incubated at 28°C on rotary shaker at 180 rpm for 6 days. These cultures were used as seed culture (first stage). For Trichothecinol –A production, 20 mL seed culture was transferred to 500 mL Erlenmeyer flask containing modified S7 medium [21]. The flasks were incubated at 28°C for 30 days as stationary culture (second stage). After incubation, the cultures were harvested and passed through sterile cotton to separate mycelial mat from culture filtrate. The culture filtrate was lyophilized and extracted thrice with equal volumes of ethyl acetate. The extracts were pooled and dried with anhydrous sodium sulphate and concentrated at 40°C under reduced pressure to yield crude extract. The antifungal activity and a method developed by Sorenson et. al. was used to detect Trichothecinol-A in crude extract [22]. The culture (AAP-PS-1) producing Trichothecinol-A was used for further studies.

Identification of endophytic fungus producing Trichothecinol-A by morphological and molecular methods

Identity of endophytic fungal culture (AAP-PS-1) producing Trichothecinol-A was established by using morphological and molecular approaches. For studying the morphological features, the fungus was grown on potato dextrose agar (potato 25%, dextrose 2%, agar 2%). Morphological characteristics of the fungus like mycelia, conidiophores and conidia were microscopically studied (Carl Ziess Axiovert 25 Inverted microscope and Nikon Eclipse E200). The genomic DNA was isolated by salting out method with little modification [23]. Sonication for a period of 5 min was done before lysozyme treatment. ITS region of genomic DNA was amplified using ITS1 TCCGTAGGTGAACCTGCGG (forward) and ITS4 TCCTCCGCTTATTGATATGC (reverse) primers. PCR products were eluted from agarose gel by protocol described in Axygen™ gel elution kit, Biosciences USA. The purified PCR product was ligated with pGEM-T vector and transformed into competent E.coli XL-1 cells [24]. Plasmid containing the insert was isolated using alkaline lysis method [24]. The cloned fragments were sequenced using Sangers dideoxy method using ABI prism big dye terminator cycle sequencing kit from ABI system [25]. The sequence obtained was further analysed for its homology by using online tool nucleotide BLAST. The multiple sequence alignments were carried out using CLUSTAL-W and phylogenetic inferences were obtained using the maximum-likelihood method within MEGA program. The bootstrap of consensus tree was inferred from 500 replicates. The evolutionary distances were computed using the Kimura2 parameter. All positions containing gaps and missing data were eliminated from the dataset (Complete deletion option). Acremonium strictum were used as an out-group.

Purification and quantification of Trichothecinol-A

Trichothecinol-A was purified using preperative TLC and RP-HPLC. TLC plates coated with 0.5 mm thickness of silica were used for preparative TLC. Approximately 0.5 mL of crude sample dissolved in methanol was loaded on to plate and developed in hexane: ethyl acetate (2:1) solvent system. The developed plates were air dried and exposed to iodine vapours. Individual bands were scrapped, eluted with ethyl acetate, concentrated in vacuo and tested for antifungal activity against Aspergillus niger by agar well diffusion method. Out of eight bands, second and fifth band showed good antifungal activity. The second band was further processed for purification by analytical RP HPLC. HPLC analysis was performed on a Waters model using a C18 symmetry pack column with the flow rate of 0.5 mL/min and eluted with a 40 minutes gradient of water: actonitrile (95: 5). The Trichothecinol-A was detected by a dual mode wavelength detector set at 220 nm and 240 nm.

Quantification of Trichothecinol-A by HPLC

Stock solution of different concentrations (1 mg/ml, 3 mg/ml, 5 mg/ml and 10 mg/ml) of a purified Trichothecinol-A was prepared in HPLC grade acetonitrile. 10 μl of each stock solution was injected in HPLC to generate a standard graph of peak area v/s concentration. Then, the known volume of (10 μl) crude dissolved in HPLC grade acetonitrile containing unknown concentration of Trichothecinol-A was analysed by HPLC and the peak area of Trichothecinol-A containing peak was compared to standard graph to calculate its concentration.

Complete characterization of Trichothecinol-A

UV-visible spectroscopy measurements were carried out on Jasco dual beam spectrophotometer (model V- 570) operated at resolution of 1 nm. Molecular mass of the compound was determined by M/S Applied Biosystems API QSTAR pulsar (ESI-MS) mass spectrometer. HRMS analysis was carried out using mass spectrometry instrument (model – Autoconcept) by direct injection probe with resolving power of 6000. FTIR spectroscopy measurements of purified compound taken in Kbr pellet were carried out using a Perkin-Elmer spectrum one instrument. Spectrometer was used in the diffuse reflectance mode of resolution 2 cm−1. All the NMR measurements were carried out on Bruker AV 500 spectrometer operating at 500 MHz and 125 MHz, respectively for 1H and 13C. ~10 mg of the compound was dissolved in CDCl3 in a 5 mm NMR tube and the 1H, 13C, COSY, NOESY, TOCSY, 13C–1H HSQC and 13C–1H HMBC experiments were performed under standard conditions using a 5 mm BBFO probe at ambient temperature (~ 25°C). Chemical shifts in the 1H spectra were referenced to residual CHCl3 peak (7.26 ppm), while 13C spectra were referenced to CDCl3 (77.0 ppm).

Antifungal assay

The purified compound was analyzed for antifungal activity against different plant pathogenic, saprophytic fungi and yeast. Antifungal assay was performed in microtiter plates as reported earlier [26, 27]. Fungal spores were removed from a 4 days old culture, transferred to YM broth (Glucose 1%, Malt extract 0.3%, Yeast extract 0.3%) and adjusted to 2x105 spores or cells/mL. The compound was diluted in DMSO to get desired concentrations. 50 μL aliquots of spores were mixed with different concentrations of compounds (10 to 100 μg/mL in 10 μL of DMSO). Final volume was adjusted by adding 140 μL YM media. Total assay volume was 200 μL. The plates were incubated at 28°C for 48 h.

OD 600 measurements

The OD 600 measurements were carried out on microtiter plate reader (Bio-Rad xMark). The MIC was determined as the lowest concentration of Trichothecinol-A that completely inhibits visible growth of the microorganism. The dose response curves were obtained by plotting concentration of compound v/s% growth inhibition. The IC50 values were determined as the concentration of Trichothecinol-A that could show 50% of maximum inhibition.

Cell culture and reagents

Human breast adenocarcinoma (MDA-MB-231), human cervical cancer (HeLa) and murine melanoma (B16F10) cell lines were obtained from American Type Culture Collection and were grown in L-15, DMEM and RPMI media respectively, supplemented with 10% fetal bovine serum and 100 U/mL Penicillin and Streptomycin (Invitrogen). All cells were grown in humidified atmosphere with or without 5% CO2 and 95% air at 37°C. Tetrazolium dye and Propidium Iodide was purchased from Sigma.

Cell viability assay

MDA-MB-231, HeLa and B16F10 cells (2x104) were seeded in 96 well plates. Cells were treated with Trichothecinol-A for 24 h with indicated concentration. Treatment was terminated by removing media and MTT [3-(4,5-dimethylthiazol-2yl)-2,5-diphenyl tetrazolium bromide] (0.5 mg/ml) was added. After 4 h, crystals were dissolved in isopropanol and A570 was recorded.

Flow cytometry analysis

Flow cytometry experiments were performed as described earlier [28]. Murine melanoma B16F10 cells were treated with indicated concentrations of Trichothecinol-A in RPMI media supplemented with 10% fetal bovine sera for 12 and 24 h. DNA analysis was done and cell undergoing apoptosis were determined following propidium iodide staining (FACS Calibar, Becton Dickinson).

Wound assay

Wound assay was performed with post confluent MDA-MB-231 cells as described [29]. Briefly, uniform sized wounds were made. MDA-MB-231 cells were treated with 2.5 μM of Trichothecinol-A. DMSO was used as vehicle control. After 18 h, photographs were taken and the area of migrated cells was quantified using Image Pro Plus 6.0 software (Nikon).

Statistical analysis

The data reported in cytotoxicity and cell migration experiments are expressed as mean ± S.E. Statistical differences were determined by Student’s t test. The p value < 0.05 was considered significant.

Conclusion

We for the first time have isolated a sesquiterpene viz. Trichothecinol-A produced by an endophytic fungus Trichothecium sp. isolated from medicinal herb Phyllanthus amarus. The compound was purified and characterized by using different chromatographic and spectroscopic techniques. Being non proteinaceous in nature, this compound holds the promise of potent antiproliferative and most importantly antimetastic lead, if suitably modified by employing combinatorial chemistry approaches to enhance its drug like properties. Trichothecinol-A exhibits appreciable antimetastatic activity against human breast carcinoma (MDA-MBA-231) and antiproliferative activity against skin carcinoma (B16F10) at nanomolar concentrations. Also, Trichothecinol-A showed good antifungal activity against Cryptococcus albidus var diffluens (NCIM 3371 and 3372) and Penicillium expansum (NCIM 939). Therefore, the above compound could be used as scaffold in drug discovery programmes to synthesize effective and more specific analogues which can be further developed as drugs. Further studies are required to understand the mechanism by which this compound inhibit cancer cell growth and metastasis.

References

  1. Tan RX, Zou WX: Endophytes: a rich source of functional metabolites. Nat Prod Rep. 2001, 18: 448-459. 10.1039/b100918o.

    Article  CAS  Google Scholar 

  2. Gunatilaka AAL: Natural products from plant-associated microorganisms: distribution, structural diversity, bioactivity, and implications of their occurrence. J Nat Prod. 2006, 69: 509-526. 10.1021/np058128n.

    Article  CAS  Google Scholar 

  3. Zhou L, Zhao J, Xu L, Huang Y, Ma Z, Wang JJW: Antimicrobial compounds produced by plant endophytic fungi. In Fungicides: Chemistry. 2009, New York: Publishers, 91-119.

    Google Scholar 

  4. Bretz M, Beyer M, Cramer B, Knecht A, Humpf HU: Thermal degradation of the Fusarium mycotoxin deoxynivalenol. J Agric Food Chem. 2006, 54: 6445-6451. 10.1021/jf061008g.

    Article  CAS  Google Scholar 

  5. Hazel CM, Patel S: Influence of processing on trichothecene levels. Toxicol Lett. 2004, 153: 51-59. 10.1016/j.toxlet.2004.04.040.

    Article  CAS  Google Scholar 

  6. Middlebrook JL, Leatherman DL: Specific association of T-2 toxin with mammalian cells. Biochem Pharmacol. 1989, 38: 3093-3102. 10.1016/0006-2952(89)90020-8.

    Article  CAS  Google Scholar 

  7. Wannemacher RW, Winer SL: Trichothecene Mycotoxins. Medical Aspects of Chemical and Biological Warfare. Edited by: Sidell RR, Takafuji ET, Franz DRE. 1977, Washington DC: Office of the Surgeon General at TMM Publications, 655-676.

    Google Scholar 

  8. Bamburg J: Biological and biochemical actions of trichothecene mycotoxins. Prog Mol Subcell Biol. 1983, 8: 41-110. 10.1007/978-3-642-69228-4_3.

    Article  CAS  Google Scholar 

  9. Konishi K, Iida A, Kaneko M, Tomioka K, Tokuda H, Nishino H, Kumeda Y: Cancer preventive potential of trichothecenes from Trichothecium roseum. Bioorg Med Chem. 2003, 11: 2511-2518. 10.1016/S0968-0896(03)00215-3.

    Article  CAS  Google Scholar 

  10. Chopra RN, Nayar SL, Chopra IC: Glossary of Indian Medicinal Plants. 1956, National Institute of Science Communication and Information Resources, Council of Scientific & Industrial Research: New Delhi, India

    Google Scholar 

  11. Kirtikar KR, Basu BD: Indian Medicinal Plants. 2001, Uttranchal, India: Oriental Enterprises, 3068-3069. 2

    Google Scholar 

  12. Reddy KR: Folk medicine from Chittoor district, Andhra Pradesh, India, used in the treatment of jaundice. Int J Crude Drug Res. 1988, 26: 137-140.

    Article  Google Scholar 

  13. Satyavati GV, Gupta AK, Tandon N: Medicinal plants of India. 1987, New Delhi: Indian Council of Medical Research, 405-411.

    Google Scholar 

  14. Barnett H: Illustrated genra of imperfect fungi. 1969, Minneapolis: Burgess publishing company, 66-67. Second

    Google Scholar 

  15. Hedley BD, Winquist E, Chambers AF: Therapeutic targets for antimetastatic therapy. Expert Opin Ther Targets. 2004, 8: 527-536. 10.1517/14728222.8.6.527.

    Article  CAS  Google Scholar 

  16. Wyckoff JB, Jones JG, Condeelis JS, Segall JE: A critical step in metastasis: in vivo analysis of intravasation at the primary tumor. Cancer Research. 2000, 60: 2504-2511.

    CAS  Google Scholar 

  17. Ahmad A: Investigations on the grassy-shoot disease of lemongrass (Cymbopogon flexuosus) and characterization of toxic metabolites produced by the causal agent Balansia sclerotica. 1991, Lucknow: University of Lucknow

    Google Scholar 

  18. Bills GF, Redlin SC, Carris LM: Endophytic fungi in grasses and woody plants: systematics, ecology, and evolution. Isolation and analysis of endophytic fungal communities from woody plants. Edited by: Redlin SC, Carris LM. 1996, St Paul: American Phytopathological Society Press, 31-65.

    Google Scholar 

  19. Janardhanan KK, Ahmad A, Gupta ML, Hussain A: Grassy- shoot, a new disease of lemongrass caused by Balansia sclerotica (Pat) Hohnel. J Phytopathology. 1991, 133: 163-168. 10.1111/j.1439-0434.1991.tb00149.x.

    Article  Google Scholar 

  20. Strobel GA, Hess WM, Ford E, Sidhu RS, Yang X: Taxol from fungal endophytes and the issue of biodiversity. J Ind Microbiol. 1996, 17: 417-423. 10.1007/BF01574772.

    Article  CAS  Google Scholar 

  21. Stierle A, Strobel G, Stierle D: Taxol and taxane production by Taxomyces andreanae, an endophytic fungus of Pacific yew. Science. 1993, 260: 214-216. 10.1126/science.8097061.

    Article  CAS  Google Scholar 

  22. Sorenson WG, Sneller MR, Larsh HW: Qualitative and quantitative assay of trichothecin: a mycotoxin produced by Trichothecium roseum. Appl Microbiol. 1975, 29: 653-657.

    CAS  Google Scholar 

  23. Neumann B, Pospiech A, Schairer HU: Rapid isolation of genomic DNA from gram-negative bacteria. Trends Genet. 1992, 8: 332-333.

    Article  CAS  Google Scholar 

  24. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning, Volume 68. 1989, New York: Cold Spring Harbor Laboratory Press, 1232-1239.

    Google Scholar 

  25. Sanger F, Nicklen S, Coulson AR: DNA sequencing with chain terminating inhibitors. Proc Natl Acad Sci USA. 1977, 74: 5463-5467. 10.1073/pnas.74.12.5463.

    Article  CAS  Google Scholar 

  26. Cavalieri SJ: Manual of Antimicrobial Susceptibility Testing. 2005, Washington DC: American Society for Microbiology, 53-62.

    Google Scholar 

  27. Amsterdam D: Susceptibility testing of antimicrobials in liquid media. Antibiotics in Laboratory Medicine, Volume 4. Edited by: Williams LV. 2005, Baltimore: Wilkins, 61-143.

    Google Scholar 

  28. Valli C, Paroni G, Di Francesco AM, Riccardi R, Tavecchio M, Erba E, Boldetti A, Gianni’ M, Fratelli M, Pisano C, Merlini L, Antoccia A, Cenciarelli C, Terao M, Garattini E: Atypical retinoids ST1926 and CD437 are S-phase-specific agents causing DNA double-strand breaks: significance for the cytotoxic and antiproliferative activity. Mol Cancer Ther. 2008, 7: 2941-2954. 10.1158/1535-7163.MCT-08-0419.

    Article  CAS  Google Scholar 

  29. Chakraborty G, Jain S, Kale S, Raja R, Kumar S, Mishra R, Kundu G: Curcumin suppresses breast tumor angiogenesis by abrogating osteopontin-induced VEGF expression. Mol Med Rep. 2008, 1: 641-646.

    CAS  Google Scholar 

Download references

Acknowledgments

R T thanks Department of Biotechnology, Government of India for research scholarship. AA thanks the Department of Biotechnology, Government of India (New Delhi) for the Tata Innovation Fellowship award and financial support through BSC0112 CSIR. We thank Dr. Sujata Biswas and Mr. Senthilkumar for HRMS analysis at the Centre for Materials Characterisation, CSIR-National Chemical Laboratory (NCL), Pune (Maharashtra, India). The National Collection of Industrial Microorganisms, CSIR-NCL, Pune (India) duly acknowledged for providing fungal and yeast cultures for antifungal assay. The authors also thank Dr. H.B Borate, Department of Organic Chemistry Division, CSIR-NCL, Pune (India) for his fruitful suggestions and Mrs. Shantha Kumari, Center for Materials Characterization (CMC), CSIR-NCL, Pune for assistance regarding ESI-MS and MS/MS measurements.

Author information

Authors and Affiliations

  1. Division of Biochemical Sciences, CSIR-National Chemical Laboratory, Dr. Homi Bhabha Road, Pune, 411008, India

    Ravindra Taware, Prasad Abnave & Absar Ahmad

  2. Central NMR facility, CSIR-National Chemical Laboratory, Dr. Homi Bhabha Road, Pune, 411008, India

    Deepak Patil & Pattuparambil Ramanpillai Rajamohananan

  3. National Centre for Cell Science, NCCS Complex, Pune University Campus, Pune, 411007, India

    Remya Raja, Gowrishankar Soundararajan & Gopal Chandra Kundu

Authors
  1. Ravindra Taware
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Prasad Abnave
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Deepak Patil
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Pattuparambil Ramanpillai Rajamohananan
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Remya Raja
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Gowrishankar Soundararajan
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Gopal Chandra Kundu
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Absar Ahmad
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Absar Ahmad.

Additional information

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

RT isolated, purified and characterized the compound and helped in preparing the manuscript. PA assisted during antifungal assay. DP and PRR helped in evaluation of NMR measurements. RR, GS and GK carried out cytotoxicity experiments with cell lines. AA conceived the study, designed the experiments and wrote the manuscript. All authors have read and approved the final manuscript.

Electronic supplementary material

40508_2013_24_MOESM1_ESM.doc

Additional file 1: Figure S1: HPLC was carried out using waters separation module. Figure S2: UV-visible spectroscopy measurements were carried out on Perkin Elmer spectrophotometer (model lambda - 750) operated at resolution of 1nm. Maximum Uv absorption was observed at 251nm in ethyl acetate. Figure S3: FTIR spectroscopy measurements of purified compound taken in Kbr pellet were carried out using a Perkin-Elmer spectrum one instrument. Figure S4: Molecular mass of the compound was determined by M/S Applied Biosystems API QSTAR pulsar (ESI-MS) mass spectrometer. Figure S5: 500 MHz 1H NMR spectrum of Trichothecinol –A in CDCl3. Figure S6: 125 MHz 13C NMR spectrum of Trichothecinol -A in CDCl3. Figure S7: DEPT 135 spectrum of Trichothecinol -A, where the CH2 carbons appear with a negative phase. Figure S8: 500 MHz COSY spectrum of Trichothecinol –A in 99.8% deuterated CDCl3. The cross peaks indicates scalar couplings. Figure S9: 500 MHz NOESY spectrum of the Trichothecinol-A in 99.8% deuterated CDCl3 A mixing time of 1 second was employed for the measurement. Figure S10: 500 MHz TOCSY correlations of the Trichothecinol-A in CDCl3. Figure S11:1H-13C HSQC spectrum of the Trichothecinol-A with the 1H and 13C DEPT spectra shown as projections in the F2 and F1 dimensions, respectively. Figure S12:1H-13C HMBC correlations of the Trichothecinol-A. Figure S13: Dose response curves of Trichothecinol-A. Table S1: Homo nuclear correlations observed in Trichothecinol-A. Table S2: Major 1H-13C correlations observed in Trichothecinol-A. (DOC 1 MB)

Authors’ original submitted files for images

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 2.0 International License ( https://creativecommons.org/licenses/by/2.0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Reprints and permissions

About this article

Cite this article

Taware, R., Abnave, P., Patil, D. et al. Isolation, purification and characterization of Trichothecinol-A produced by endophytic fungus Trichotheciumsp. and its antifungal, anticancer and antimetastatic activities. Sustain Chem Process 2, 8 (2014). https://doi.org/10.1186/2043-7129-2-8

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/2043-7129-2-8

Keywords